Review



moffat lab  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc moffat lab
    Moffat Lab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6145 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/moffat+lab/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__02__18__706452-261-15-17
    Average 96 stars, based on 6145 article reviews
    moffat lab - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: ZNF121 recruits YTHDF2 to modulate mRNA stability
    Article Snippet: .. CRISPR-mediated gene knockouts were performed using the LentiCRISPRv2 plasmid, which was kindly provided by the Moffat Lab (Addgene plasmid #52961). .. Guide RNA (gRNA) sequences from the Toronto KnockOut version 3 (TKOv3) library for ZNF121 (AATGTGGAAGAGCCTTCGCT) and YTHDF2 (ATATAGGTCAGCCAACCCAG) were each cloned into the LentiCRISPRv2 vector and transfected into 293T cells to produce lentiviral particles Flp-InTMT-REx HEK293 cells were infected with lentivirus at an MOI of ∼0.3 in the presence of polybrene (8ug/mL; Sigma-Aldrich, Cat # H9268), selected with puromycin (2μg/mL; BioShop Canada Inc., Cat # PUR333.25) for 3 days and grown for 3 more days.

    Plasmid Preparation:

    Article Title: ZNF121 recruits YTHDF2 to modulate mRNA stability
    Article Snippet: .. CRISPR-mediated gene knockouts were performed using the LentiCRISPRv2 plasmid, which was kindly provided by the Moffat Lab (Addgene plasmid #52961). .. Guide RNA (gRNA) sequences from the Toronto KnockOut version 3 (TKOv3) library for ZNF121 (AATGTGGAAGAGCCTTCGCT) and YTHDF2 (ATATAGGTCAGCCAACCCAG) were each cloned into the LentiCRISPRv2 vector and transfected into 293T cells to produce lentiviral particles Flp-InTMT-REx HEK293 cells were infected with lentivirus at an MOI of ∼0.3 in the presence of polybrene (8ug/mL; Sigma-Aldrich, Cat # H9268), selected with puromycin (2μg/mL; BioShop Canada Inc., Cat # PUR333.25) for 3 days and grown for 3 more days.

    Knock-Out:

    Article Title: Next Generation Sequencing
    Article Snippet: A similar library was also generated by the Sabatini and Lander labs targeting human protein coding genes (Addgene #1000000067) as well as targeted sublibraries (Addgene #51043–51048). .. Second generation libraries built by improving the specificity of sgRNA guides include the Toronto knockout (TKO) library generated by the Moffat lab (Addgene #1000000069) and the Brunello (Addgene #73178 or #73179)/Brie (Addgene #73632 or #73633) libraries from the Broad Institute Genetic Pertubation Platform (GPP) lab. .. Second generation libraries built by improving the specificity of sgRNA guides include the Toronto knockout (TKO) library generated by the Moffat lab (Addgene #1000000069) and the Brunello (Addgene #73178 or #73179)/Brie (Addgene #73632 or #73633) libraries from the Broad Institute Genetic Pertubation Platform (GPP) lab.

    Generated:

    Article Title: Next Generation Sequencing
    Article Snippet: A similar library was also generated by the Sabatini and Lander labs targeting human protein coding genes (Addgene #1000000067) as well as targeted sublibraries (Addgene #51043–51048). .. Second generation libraries built by improving the specificity of sgRNA guides include the Toronto knockout (TKO) library generated by the Moffat lab (Addgene #1000000069) and the Brunello (Addgene #73178 or #73179)/Brie (Addgene #73632 or #73633) libraries from the Broad Institute Genetic Pertubation Platform (GPP) lab. .. Second generation libraries built by improving the specificity of sgRNA guides include the Toronto knockout (TKO) library generated by the Moffat lab (Addgene #1000000069) and the Brunello (Addgene #73178 or #73179)/Brie (Addgene #73632 or #73633) libraries from the Broad Institute Genetic Pertubation Platform (GPP) lab.



    Similar Products

    moffat lab  (Addgene inc)
    96
    Addgene inc moffat lab
    Moffat Lab, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/moffat+lab/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__02__18__706452-261-15-17
    Average 96 stars, based on 1 article reviews
    moffat lab - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results